Sample Biology Questions On Reproduction

Homework Question on Reproduction

  1. Do cells that do different jobs in our body contain different genes? Explain why or why not.
  2. What amino acid sequence would be produced with the following mRNA sequence?auggacaucgccauccaccacccc
  3. What factors affect the duration of the “fertile window” in humans? According to Robert Martin, why might this window be longer than previously thought?
  4. Explain how the optokinetic response assay can be used to identify genes involved in zebrafish vision?
  5. Now that you have taken this class, what do you think was the greatest misconception you had about science and/or biology before this semester? Is there any aspect of biology or science that you now think of differently?
  6. You probably found in the natural selection game you played a few modules ago that having genetic diversity provides possible adaptations that will allow a population to survive changes in its environment. Describe two ways that sexual reproduction produces more genetic diversity than the asexual cloning used by bacteria when they reproduce.
  • Longer answer questions
  1. We have spent much of the course discussing the roles of many different proteins. Pick three of the proteins we have covered in this class and for each do the following:
  2. Describe where the protein occurs (what tissue or cell).
  3. Explain the protein’s normal function.  What does it do in the body?
  4. Is there a disease caused when this protein is abnormal?  If so, give a brief description of how the disease affects normal function.  If you cannot find an example of a related disease, predict what might happen if the protein did not work properly
  5. Describe TWO different ways that neurotoxins can affect the function of a synapse and produce paralysis. Use TWO specific examples of neurotoxins and mention the structures in the synapse that they affect.
  6. You are working as a psychiatrist and have a patient experiencing something odd. This patient recently had their corpus callosum surgically severed to limit the severity of epileptic seizures. Ever since their operation they have noticed that when holding objects in their left hand they could not remember the name for these common objects. But when they moved the object to their right hand the name came to them. Explain why and how this is happening?

Homework Answer on Reproduction

  1. Different cells in our bodies have genes. Each cell regardless of its function or form has a complete set of DNA in each gene. The DNA structure and composition is similar for all somatic cells. This is because in all the 23 pairs of chromosomes within a human cell there are equal numbers of genes and DNA and hence all the genetic instructions making up a human genome.
  2. Atggacatcgccatccaccacccc
  3. Some of the factors that affect the fertile window are changes and differences in age as well as the level of fertility, ovulation period and menstrual cycle and to some extent previous pregnancies as well as frequencies in sexual intercourse. According to Robert Martin however, the window may be longer because of the variability that exists between the copulation dates and the duration of pregnancies. This is because it will consequently reflect a real variation on the intervals between births and conception.

Homework Help4. Optokinetic responses and behaviors of the zebrafish larvae can be examined and used in the screening for the presence of their high visual system. This is because the optokinetic response can easily be detected rapidly even in 5 day old larvae. The genes involved in vision can be identified through measuring the optokinetic responses of specially mutagenized larvae which are then used as a genetic screen for the presence of vision. The zebrafish exhibit behaviors that are vision dependent hence their high vision which matures as early as 3 days after fertilization.